lentiviral vectors interfering with ltk expression and the negative control shctrl Search Results


96
Santa Cruz Biotechnology non targeting shrna
Effect of Dbait on H2AX phosphorylation. (A) SK28 and 501mel melanoma cells were transfected with an inactive control oligonucleotide or Dbait ± NU7026 (DNA-PK inhibitor). Immunofluorescence of γ-H2AX (red) and chromatin (DAPI; blue) was visualized. Dbait treatment led to non-localized pan-nuclear H2AX phosphorylation evidencing Dbait activity. This activity was dependent on DNA-PK activation. Bar, 50 μm. (B) SK28 melanoma cells were transfected with an inactive control oligonucleotide or Dbait. Immunofluorescence of γ-H2AX (red) and chromatin (DAPI; blue) was visualized immediately after irradiation and/or Dbait treatment. Irradiation alone resulted in localized γ-H2AX foci representing radio-induced DNA DSBs; Dbait treatment with or without irradiation led to non-localized pan-nuclear H2AX phosphorylation evidencing Dbait activity. Bar, 30 μm. (C) SK28 cells were transduced with lentiviruses that express either control, non-targeting <t>shRNA,</t> or shRNA targeting DNA-PKcs. After Dbait transfection, cells were immunostained with mouse monoclonal anti–DNA-PKcs or anti–γ-H2AX. Dbait activity was not detected in cells transduced with shRNA targeting DNA-PKcs. Bar, 50 μm.
Non Targeting Shrna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+interfering+with+ltk+expression+and+the+negative+control+shctrl/pmc04212251-78-12-16?v=Santa+Cruz+Biotechnology
Average 96 stars, based on 1 article reviews
non targeting shrna - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

90
Shanghai GenePharma control lentivirus
Effect of GATA4 on odontoblasts polarization, cell proliferation and secretion of root dentin matrix. ( A ) H&E-stained sections of the mandibular first molars showed that the odontoblasts have shorter height and flattened morphology in Wnt1-Cre;GATA4 fl/fl mice at P14 and P21 (Bar: 50 μm). ( B-E ) Immunohistochemistry staining images showing expression levels of DSPP (B), COL-1 (C), DCN (D), and PCNA (E) in root of Wnt1-Cre;GATA4 fl/fl mice at P14. ( F ) The height of odontoblasts was measured. Quantitative assessment of the molar root odontoblasts height from (A) at P14 and P21. ( G-J ) Percentages of DSPP (G), COL-1 (H), DCN (I), and PCNA-positive (J) cells in the control and mutant groups were calculated. ( K ) Double-labeled fluorescent immunostaining of DAPI-stained cell nuclei (blue), GFP (green), and merged images in tooth root at P17 after the injetion in vivo (Bar: 50 μm). ( L ) H&E-stained sections of the mandibular first molars showed that root dentin thickness was increased in GATA4 OE group mice at P17 (Bar: 50 μm). ( M ) Quantitative assessment of the molar root dentin thickness at P17. ( N ) Expression of GATA4 after <t>lentivirus</t> injected at P17 (Bar: 100 μm). ( O ) Percentages of GATA4-positive cells in the two groups were calculated. ( P ) Immunohistochemistry staining images showing expression levels of DSPP, COL-1, and DCN in root of mice at P17. ( Q ) Percentages of DSPP, COL-1, and DCN-positive cells in the two groups were calculated. Data expressed as the mean ± standard deviation, n = 3. * P < 0.05, ** P < 0.01.
Control Lentivirus, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+interfering+with+ltk+expression+and+the+negative+control+shctrl/pmc06930368-58-8-23?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
control lentivirus - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

86
Genechem control lentiviral particles shctrl
Exploration of potential downstream mechanism and upstream regulators of CCDC137. A Heatmap shows DEGs identified by RNA sequencing in <t>T24-shCtrl</t> and T24-shCCDC137-1 cells. B Bar plot displays GO and KEGG functional enrichment results of downregulated DEGs from RNA sequencing. C GSVA-Hallmark pathway enrichment analysis displayed differences between CCDC137 positive (CCDC137 +) and CCDC137 negative (CCDC137 −) cells based on single-cell sequencing data. D mRNA and protein expression of stearoyl-CoA desaturase (SCD) were detected by qRT-PCR and Western blot. E DecoupleR was used to analyze differences in transcription factor activity between CCDC137 + and CCDC137 − epithelial cells in single-cell sequencing data. F TF-Target Finder was employed to identify potential upstream transcription factors of CCDC137. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance
Control Lentiviral Particles Shctrl, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+interfering+with+ltk+expression+and+the+negative+control+shctrl/pmc12462137-114-6-13?v=Genechem
Average 86 stars, based on 1 article reviews
control lentiviral particles shctrl - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

96
Addgene inc lentiviral vector shrna control shctrl
Exploration of potential downstream mechanism and upstream regulators of CCDC137. A Heatmap shows DEGs identified by RNA sequencing in <t>T24-shCtrl</t> and T24-shCCDC137-1 cells. B Bar plot displays GO and KEGG functional enrichment results of downregulated DEGs from RNA sequencing. C GSVA-Hallmark pathway enrichment analysis displayed differences between CCDC137 positive (CCDC137 +) and CCDC137 negative (CCDC137 −) cells based on single-cell sequencing data. D mRNA and protein expression of stearoyl-CoA desaturase (SCD) were detected by qRT-PCR and Western blot. E DecoupleR was used to analyze differences in transcription factor activity between CCDC137 + and CCDC137 − epithelial cells in single-cell sequencing data. F TF-Target Finder was employed to identify potential upstream transcription factors of CCDC137. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance
Lentiviral Vector Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+interfering+with+ltk+expression+and+the+negative+control+shctrl/pmc09283934-178-0-6?v=Addgene+inc
Average 96 stars, based on 1 article reviews
lentiviral vector shrna control shctrl - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

90
Shanghai GenePharma synthetic lentivirus-based shrnas shneat1v2, shneat1-mus and shctrl
Exploration of potential downstream mechanism and upstream regulators of CCDC137. A Heatmap shows DEGs identified by RNA sequencing in <t>T24-shCtrl</t> and T24-shCCDC137-1 cells. B Bar plot displays GO and KEGG functional enrichment results of downregulated DEGs from RNA sequencing. C GSVA-Hallmark pathway enrichment analysis displayed differences between CCDC137 positive (CCDC137 +) and CCDC137 negative (CCDC137 −) cells based on single-cell sequencing data. D mRNA and protein expression of stearoyl-CoA desaturase (SCD) were detected by qRT-PCR and Western blot. E DecoupleR was used to analyze differences in transcription factor activity between CCDC137 + and CCDC137 − epithelial cells in single-cell sequencing data. F TF-Target Finder was employed to identify potential upstream transcription factors of CCDC137. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance
Synthetic Lentivirus Based Shrnas Shneat1v2, Shneat1 Mus And Shctrl, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+interfering+with+ltk+expression+and+the+negative+control+shctrl/pmc07746375-207-2-28?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
synthetic lentivirus-based shrnas shneat1v2, shneat1-mus and shctrl - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

86
Genechem control lentivirus
Exploration of potential downstream mechanism and upstream regulators of CCDC137. A Heatmap shows DEGs identified by RNA sequencing in <t>T24-shCtrl</t> and T24-shCCDC137-1 cells. B Bar plot displays GO and KEGG functional enrichment results of downregulated DEGs from RNA sequencing. C GSVA-Hallmark pathway enrichment analysis displayed differences between CCDC137 positive (CCDC137 +) and CCDC137 negative (CCDC137 −) cells based on single-cell sequencing data. D mRNA and protein expression of stearoyl-CoA desaturase (SCD) were detected by qRT-PCR and Western blot. E DecoupleR was used to analyze differences in transcription factor activity between CCDC137 + and CCDC137 − epithelial cells in single-cell sequencing data. F TF-Target Finder was employed to identify potential upstream transcription factors of CCDC137. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance
Control Lentivirus, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+interfering+with+ltk+expression+and+the+negative+control+shctrl/pmc12867441-128-6-19?v=Genechem
Average 86 stars, based on 1 article reviews
control lentivirus - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology non specific shrna control shctrl lentiviral pool plasmids
A) Western blot analysis of HeLa cells following CYB5D2 <t>shRNA-mediated</t> knockdown (shCYB5D2) compared to shRNA control <t>(shCTRL)</t> HeLa cells. B) Cell proliferation of HeLa cells following CYB5D2 knockdown. Experiments were conducted in quadruplicate, with triplicate replicates in each experiment. Cell numbers determined at each time point are presented as mean ± SD. ** p <0.01 (two-tailed Student’s t -test). C) Anchorage-independent growth of shCYB5D2 and shCTRL HeLa cells. Representative images of soft agar plates (top panels) and phase contrast images of colonies at 50X magnification (bottom panels). Scale bar is equal to 200 µm. D) Mean number (left panel) and mean diameter (right panel) of colonies in 10 random fields were evaluated and presented as mean ± S.E.M. of three independent experiments. ** p <0.01 (two-tailed Student’s t -test).
Non Specific Shrna Control Shctrl Lentiviral Pool Plasmids, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+interfering+with+ltk+expression+and+the+negative+control+shctrl/pmc03899279-69-4-14?v=Santa+Cruz+Biotechnology
Average 96 stars, based on 1 article reviews
non specific shrna control shctrl lentiviral pool plasmids - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Addgene inc lentiviral vector plko 1 shrna control shctrl
Reduced TIE2/ Tek levels with SFN are dependent on NRF2 activity. ( A ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Expression levels of 84 endothelial genes were analyzed by quantitative real-time PCR (qRT-PCR) and normalized to the geometric mean of Actb , Gapdh , B2m , Gusb , and Hsp90ab1 levels. Volcano plot comparing gene expression of vehicle- versus SFN-treated cells. A fold of change greater than 1.5 is represented by yellow (increased expression when compared to vehicle-treated cells) and blue (decreased expression when compared to vehicle-treated cells) dots. Data are the mean of n = 4. Statistical analysis was performed with the GeneGlobe Data Analysis Center from Qiagen. A p -value < than 0.05 was considered significant and is represented by a line. A red square highlights the Tek gene. ( B ) Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control from bEnd.3 cells maintained under low-serum conditions (16 h, 1% FBS) and treated with SFN (5 µM, 16 h). ( C ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of B expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( D ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Transcript levels of Hmox1 , Nqo1 , Slc7a11 , Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( E ) Confocal analysis of double immunofluorescence with anti-TIE2 (green) and anti-CLDN5 (red) antibodies in vehicle (Veh.) or SFN-treated bEnd.3 cells. ( F ) Quantification of TIE2 and CLDN5 intensity signals in E. Values are mean ± SD (n = 3, with >50 cells counted per field). * p < 0.05 vs. VEH-treated cells according to Student’s t -test. ( G ) bEnd.3 cells were transduced with <t>lentiviral</t> vectors carrying short hairpin RNA against NRF2 (shNRF2) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. ( H ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of G expressed as a ratio of LMNB and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and ** p < 0.01 vs. vehicle, or # p < 0.05 vs. shCTRL according to Student’s t -test. ( I ) Transcript levels of Nfe2l2 , Hmox1 , Nqo1 , and Slc7a11 and ( J ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with shNRF2 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test.
Lentiviral Vector Plko 1 Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+interfering+with+ltk+expression+and+the+negative+control+shctrl/pmc12841328-189-0-6?v=Addgene+inc
Average 96 stars, based on 1 article reviews
lentiviral vector plko 1 shrna control shctrl - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

90
Shanghai GenePharma lentiviral vectors shctrl
Reduced TIE2/ Tek levels with SFN are dependent on NRF2 activity. ( A ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Expression levels of 84 endothelial genes were analyzed by quantitative real-time PCR (qRT-PCR) and normalized to the geometric mean of Actb , Gapdh , B2m , Gusb , and Hsp90ab1 levels. Volcano plot comparing gene expression of vehicle- versus SFN-treated cells. A fold of change greater than 1.5 is represented by yellow (increased expression when compared to vehicle-treated cells) and blue (decreased expression when compared to vehicle-treated cells) dots. Data are the mean of n = 4. Statistical analysis was performed with the GeneGlobe Data Analysis Center from Qiagen. A p -value < than 0.05 was considered significant and is represented by a line. A red square highlights the Tek gene. ( B ) Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control from bEnd.3 cells maintained under low-serum conditions (16 h, 1% FBS) and treated with SFN (5 µM, 16 h). ( C ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of B expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( D ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Transcript levels of Hmox1 , Nqo1 , Slc7a11 , Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( E ) Confocal analysis of double immunofluorescence with anti-TIE2 (green) and anti-CLDN5 (red) antibodies in vehicle (Veh.) or SFN-treated bEnd.3 cells. ( F ) Quantification of TIE2 and CLDN5 intensity signals in E. Values are mean ± SD (n = 3, with >50 cells counted per field). * p < 0.05 vs. VEH-treated cells according to Student’s t -test. ( G ) bEnd.3 cells were transduced with <t>lentiviral</t> vectors carrying short hairpin RNA against NRF2 (shNRF2) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. ( H ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of G expressed as a ratio of LMNB and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and ** p < 0.01 vs. vehicle, or # p < 0.05 vs. shCTRL according to Student’s t -test. ( I ) Transcript levels of Nfe2l2 , Hmox1 , Nqo1 , and Slc7a11 and ( J ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with shNRF2 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test.
Lentiviral Vectors Shctrl, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+interfering+with+ltk+expression+and+the+negative+control+shctrl/pm33096483-77-1-9?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
lentiviral vectors shctrl - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma shrna lentivirus particles shpkm2
Depletion of pyruvate kinase M2 (PKM2) reduces the tumorigenic capacity of cells with lowly expressed lincRNA‐p21. (A) LincRNA‐p21‐silenced LNCaP cells expressing shPKM2 or <t>shCtrl</t> were implanted into nude mice (n = 8) and tumours developed. The time point of 0 day represented 3 weeks after LNCaP cells injection. (B) LincRNA‐p21‐silenced DU145 cells expressing shPKM2 or shCtrl were implanted into nude mice (n = 8) and tumours developed. Immunoblotting was preformed to examine PKM2 expression (left). Tumour initiation were recorded (middle) and survival was analysed (right)
Shrna Lentivirus Particles Shpkm2, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+interfering+with+ltk+expression+and+the+negative+control+shctrl/pmc06529145-64-3-11?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
shrna lentivirus particles shpkm2 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma vectors of lentiviral (lv) packing lv-shklf4
Depletion of pyruvate kinase M2 (PKM2) reduces the tumorigenic capacity of cells with lowly expressed lincRNA‐p21. (A) LincRNA‐p21‐silenced LNCaP cells expressing shPKM2 or <t>shCtrl</t> were implanted into nude mice (n = 8) and tumours developed. The time point of 0 day represented 3 weeks after LNCaP cells injection. (B) LincRNA‐p21‐silenced DU145 cells expressing shPKM2 or shCtrl were implanted into nude mice (n = 8) and tumours developed. Immunoblotting was preformed to examine PKM2 expression (left). Tumour initiation were recorded (middle) and survival was analysed (right)
Vectors Of Lentiviral (Lv) Packing Lv Shklf4, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+interfering+with+ltk+expression+and+the+negative+control+shctrl/pm30404815-72-4-15?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
vectors of lentiviral (lv) packing lv-shklf4 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Addgene inc lentiviral constructs plko rfp shctrl
a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
Lentiviral Constructs Plko Rfp Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+interfering+with+ltk+expression+and+the+negative+control+shctrl/bio_rxiv__2025__07__16__665171-165-0-3?v=Addgene+inc
Average 93 stars, based on 1 article reviews
lentiviral constructs plko rfp shctrl - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results


Effect of Dbait on H2AX phosphorylation. (A) SK28 and 501mel melanoma cells were transfected with an inactive control oligonucleotide or Dbait ± NU7026 (DNA-PK inhibitor). Immunofluorescence of γ-H2AX (red) and chromatin (DAPI; blue) was visualized. Dbait treatment led to non-localized pan-nuclear H2AX phosphorylation evidencing Dbait activity. This activity was dependent on DNA-PK activation. Bar, 50 μm. (B) SK28 melanoma cells were transfected with an inactive control oligonucleotide or Dbait. Immunofluorescence of γ-H2AX (red) and chromatin (DAPI; blue) was visualized immediately after irradiation and/or Dbait treatment. Irradiation alone resulted in localized γ-H2AX foci representing radio-induced DNA DSBs; Dbait treatment with or without irradiation led to non-localized pan-nuclear H2AX phosphorylation evidencing Dbait activity. Bar, 30 μm. (C) SK28 cells were transduced with lentiviruses that express either control, non-targeting shRNA, or shRNA targeting DNA-PKcs. After Dbait transfection, cells were immunostained with mouse monoclonal anti–DNA-PKcs or anti–γ-H2AX. Dbait activity was not detected in cells transduced with shRNA targeting DNA-PKcs. Bar, 50 μm.

Journal: Neoplasia (New York, N.Y.)

Article Title: A Preclinical Study Combining the DNA Repair Inhibitor Dbait with Radiotherapy for the Treatment of Melanoma 1

doi: 10.1016/j.neo.2014.08.008

Figure Lengend Snippet: Effect of Dbait on H2AX phosphorylation. (A) SK28 and 501mel melanoma cells were transfected with an inactive control oligonucleotide or Dbait ± NU7026 (DNA-PK inhibitor). Immunofluorescence of γ-H2AX (red) and chromatin (DAPI; blue) was visualized. Dbait treatment led to non-localized pan-nuclear H2AX phosphorylation evidencing Dbait activity. This activity was dependent on DNA-PK activation. Bar, 50 μm. (B) SK28 melanoma cells were transfected with an inactive control oligonucleotide or Dbait. Immunofluorescence of γ-H2AX (red) and chromatin (DAPI; blue) was visualized immediately after irradiation and/or Dbait treatment. Irradiation alone resulted in localized γ-H2AX foci representing radio-induced DNA DSBs; Dbait treatment with or without irradiation led to non-localized pan-nuclear H2AX phosphorylation evidencing Dbait activity. Bar, 30 μm. (C) SK28 cells were transduced with lentiviruses that express either control, non-targeting shRNA, or shRNA targeting DNA-PKcs. After Dbait transfection, cells were immunostained with mouse monoclonal anti–DNA-PKcs or anti–γ-H2AX. Dbait activity was not detected in cells transduced with shRNA targeting DNA-PKcs. Bar, 50 μm.

Article Snippet: Subconfluent SK28 cells were transduced with lentiviruses that expressed either the control, non-targeting shRNA (shCTL; sc-108080; Santa Cruz Biotechnology, (Dallas, Texas, USA)), or shRNA targeting DNA-PKcs (shDNA-PK; sc-35200-V; Santa Cruz Biotechnology) at a multiplicity of infection of 3 using polybrene (5 μg/ml).

Techniques: Phospho-proteomics, Transfection, Control, Immunofluorescence, Activity Assay, Activation Assay, Irradiation, Transduction, shRNA

Effect of GATA4 on odontoblasts polarization, cell proliferation and secretion of root dentin matrix. ( A ) H&E-stained sections of the mandibular first molars showed that the odontoblasts have shorter height and flattened morphology in Wnt1-Cre;GATA4 fl/fl mice at P14 and P21 (Bar: 50 μm). ( B-E ) Immunohistochemistry staining images showing expression levels of DSPP (B), COL-1 (C), DCN (D), and PCNA (E) in root of Wnt1-Cre;GATA4 fl/fl mice at P14. ( F ) The height of odontoblasts was measured. Quantitative assessment of the molar root odontoblasts height from (A) at P14 and P21. ( G-J ) Percentages of DSPP (G), COL-1 (H), DCN (I), and PCNA-positive (J) cells in the control and mutant groups were calculated. ( K ) Double-labeled fluorescent immunostaining of DAPI-stained cell nuclei (blue), GFP (green), and merged images in tooth root at P17 after the injetion in vivo (Bar: 50 μm). ( L ) H&E-stained sections of the mandibular first molars showed that root dentin thickness was increased in GATA4 OE group mice at P17 (Bar: 50 μm). ( M ) Quantitative assessment of the molar root dentin thickness at P17. ( N ) Expression of GATA4 after lentivirus injected at P17 (Bar: 100 μm). ( O ) Percentages of GATA4-positive cells in the two groups were calculated. ( P ) Immunohistochemistry staining images showing expression levels of DSPP, COL-1, and DCN in root of mice at P17. ( Q ) Percentages of DSPP, COL-1, and DCN-positive cells in the two groups were calculated. Data expressed as the mean ± standard deviation, n = 3. * P < 0.05, ** P < 0.01.

Journal: International Journal of Biological Sciences

Article Title: GATA Binding Protein 4 Regulates Tooth Root Dentin Development via FBP1

doi: 10.7150/ijbs.36567

Figure Lengend Snippet: Effect of GATA4 on odontoblasts polarization, cell proliferation and secretion of root dentin matrix. ( A ) H&E-stained sections of the mandibular first molars showed that the odontoblasts have shorter height and flattened morphology in Wnt1-Cre;GATA4 fl/fl mice at P14 and P21 (Bar: 50 μm). ( B-E ) Immunohistochemistry staining images showing expression levels of DSPP (B), COL-1 (C), DCN (D), and PCNA (E) in root of Wnt1-Cre;GATA4 fl/fl mice at P14. ( F ) The height of odontoblasts was measured. Quantitative assessment of the molar root odontoblasts height from (A) at P14 and P21. ( G-J ) Percentages of DSPP (G), COL-1 (H), DCN (I), and PCNA-positive (J) cells in the control and mutant groups were calculated. ( K ) Double-labeled fluorescent immunostaining of DAPI-stained cell nuclei (blue), GFP (green), and merged images in tooth root at P17 after the injetion in vivo (Bar: 50 μm). ( L ) H&E-stained sections of the mandibular first molars showed that root dentin thickness was increased in GATA4 OE group mice at P17 (Bar: 50 μm). ( M ) Quantitative assessment of the molar root dentin thickness at P17. ( N ) Expression of GATA4 after lentivirus injected at P17 (Bar: 100 μm). ( O ) Percentages of GATA4-positive cells in the two groups were calculated. ( P ) Immunohistochemistry staining images showing expression levels of DSPP, COL-1, and DCN in root of mice at P17. ( Q ) Percentages of DSPP, COL-1, and DCN-positive cells in the two groups were calculated. Data expressed as the mean ± standard deviation, n = 3. * P < 0.05, ** P < 0.01.

Article Snippet: Recombinant lentivirus of shRNA target GATA4 (shGATA4; 5′-GAATAAATCTAAGACACCA-3′), control lentivirus (shCTRL; 5′-TTCTCCGAACGTGTCACGT-3′), lentivirus to overexpress GATA4 (pcDNA-GATA4) and blank lentivirus were purchased from GenePharma (Shanghai, China).

Techniques: Staining, Immunohistochemistry, Expressing, Control, Mutagenesis, Labeling, Immunostaining, In Vivo, Injection, Standard Deviation

Characterization of DPSCs and expression of GATA4 in DPSCs. ( A ) Flow chart explaining cells isolation, culture and collection for FCM analyses. ( B, C ) Flow cytometry demonstrated that DPSCs expressed mesenchymal markers (CD44 and CD90) at a high level and generated the hematopoietic makers (CD14 and CD45) at a low level. ( D ) After mineralization for 3, 7, and 14 days, GATA4 protein expression was assessed at the indicated time points by western blotting. ( E ) DPSCs infected with lentivirus as assessed by fluorescence microscopy (Bar: 50 μm). ( F ) Efficiency of GATA4 knockdown after infection with lentivirus was analysed by western blotting. ( G ) Quantitative analysis of western blotting bands from (D) is shown as the ratio of GATA4 to GAPDH. ( H ) Quantitative analysis of western blotting bands from (F) is shown as the ratio of GATA4 to GAPDH. Data expressed as the mean ± standard deviation, n = 3. ** P < 0.01.

Journal: International Journal of Biological Sciences

Article Title: GATA Binding Protein 4 Regulates Tooth Root Dentin Development via FBP1

doi: 10.7150/ijbs.36567

Figure Lengend Snippet: Characterization of DPSCs and expression of GATA4 in DPSCs. ( A ) Flow chart explaining cells isolation, culture and collection for FCM analyses. ( B, C ) Flow cytometry demonstrated that DPSCs expressed mesenchymal markers (CD44 and CD90) at a high level and generated the hematopoietic makers (CD14 and CD45) at a low level. ( D ) After mineralization for 3, 7, and 14 days, GATA4 protein expression was assessed at the indicated time points by western blotting. ( E ) DPSCs infected with lentivirus as assessed by fluorescence microscopy (Bar: 50 μm). ( F ) Efficiency of GATA4 knockdown after infection with lentivirus was analysed by western blotting. ( G ) Quantitative analysis of western blotting bands from (D) is shown as the ratio of GATA4 to GAPDH. ( H ) Quantitative analysis of western blotting bands from (F) is shown as the ratio of GATA4 to GAPDH. Data expressed as the mean ± standard deviation, n = 3. ** P < 0.01.

Article Snippet: Recombinant lentivirus of shRNA target GATA4 (shGATA4; 5′-GAATAAATCTAAGACACCA-3′), control lentivirus (shCTRL; 5′-TTCTCCGAACGTGTCACGT-3′), lentivirus to overexpress GATA4 (pcDNA-GATA4) and blank lentivirus were purchased from GenePharma (Shanghai, China).

Techniques: Expressing, Isolation, Flow Cytometry, Generated, Western Blot, Infection, Fluorescence, Microscopy, Knockdown, Standard Deviation

Effect of GATA4 on migration, proliferation and odonto/osteogenic differentiation of DPSCs. ( A ) Effect of GATA4 knockdown on cell migration was assessed by wound scratch assays (Bar: 100 μm). ( B ) Effect of GATA4 knockdown on cell migration was assessed by transwell assay (Bar: 100 μm). ( C ) ALP staining observed after 7 days of mineralization (Bar: 100 μm). ( D ) After mineralization for 14 days, alizarin red staining was performed and observed with an image scanner (upper) and under a microscope (lower) (Bar: 100 μm). ( E ) The CCK8 assay was used to analyse the proliferation of DPSCs after infection with GATA4 lentivirus. ( F ) Quantitative assessment of ALP-positive areas. ( G ) Semi-quantitative estimation of calcium. ( H ) Expression levels of odonto/osteogenic-related genes (DSPP, BMP4, RUNX2, OSX, OPN, and OCN) were assessed by western blotting. ( I ) Quantitative analysis of western blotting bands from (H). ( J ) Expressions of odonto/osteogenic markers (Dspp, Dmp1, Col1a1, Bmp4, Runx2, Osx, Ocn, and Alp) were assessed by qRT-PCR. (Bar: 100 μm). Data expressed as the mean ± standard deviation; n = 3. * P < 0.05, ** P < 0.01.

Journal: International Journal of Biological Sciences

Article Title: GATA Binding Protein 4 Regulates Tooth Root Dentin Development via FBP1

doi: 10.7150/ijbs.36567

Figure Lengend Snippet: Effect of GATA4 on migration, proliferation and odonto/osteogenic differentiation of DPSCs. ( A ) Effect of GATA4 knockdown on cell migration was assessed by wound scratch assays (Bar: 100 μm). ( B ) Effect of GATA4 knockdown on cell migration was assessed by transwell assay (Bar: 100 μm). ( C ) ALP staining observed after 7 days of mineralization (Bar: 100 μm). ( D ) After mineralization for 14 days, alizarin red staining was performed and observed with an image scanner (upper) and under a microscope (lower) (Bar: 100 μm). ( E ) The CCK8 assay was used to analyse the proliferation of DPSCs after infection with GATA4 lentivirus. ( F ) Quantitative assessment of ALP-positive areas. ( G ) Semi-quantitative estimation of calcium. ( H ) Expression levels of odonto/osteogenic-related genes (DSPP, BMP4, RUNX2, OSX, OPN, and OCN) were assessed by western blotting. ( I ) Quantitative analysis of western blotting bands from (H). ( J ) Expressions of odonto/osteogenic markers (Dspp, Dmp1, Col1a1, Bmp4, Runx2, Osx, Ocn, and Alp) were assessed by qRT-PCR. (Bar: 100 μm). Data expressed as the mean ± standard deviation; n = 3. * P < 0.05, ** P < 0.01.

Article Snippet: Recombinant lentivirus of shRNA target GATA4 (shGATA4; 5′-GAATAAATCTAAGACACCA-3′), control lentivirus (shCTRL; 5′-TTCTCCGAACGTGTCACGT-3′), lentivirus to overexpress GATA4 (pcDNA-GATA4) and blank lentivirus were purchased from GenePharma (Shanghai, China).

Techniques: Migration, Knockdown, Transwell Assay, Staining, Microscopy, CCK-8 Assay, Infection, Expressing, Western Blot, Quantitative RT-PCR, Standard Deviation

Overexpression of GATA4 in DPSCs increased the odonto/osteogenic ability. ( A ) DPSCs infected with lentivirus control and pcDNA-GATA4 were observed under a fluorescence microscope (Bar: 50 μm). ( B ) Protein expression of GATA4 in the DPSCs was tested by western blotting after overexpression of GATA4. ( C ) Quantitative analysis of western blotting bands from (B). ( D ) ALP staining was observed after 7 days of mineralization. ( E ) ARS staining was performed 14 days after mineralization (Bar: 100 μm). ( F ) Quantitative assessment of ALP-positive areas after 7 days of osteogenic induction. ( G ) Semi-quantitative estimation of calcium. Data expressed as the mean ± standard deviation; n = 3. ** P < 0.01.

Journal: International Journal of Biological Sciences

Article Title: GATA Binding Protein 4 Regulates Tooth Root Dentin Development via FBP1

doi: 10.7150/ijbs.36567

Figure Lengend Snippet: Overexpression of GATA4 in DPSCs increased the odonto/osteogenic ability. ( A ) DPSCs infected with lentivirus control and pcDNA-GATA4 were observed under a fluorescence microscope (Bar: 50 μm). ( B ) Protein expression of GATA4 in the DPSCs was tested by western blotting after overexpression of GATA4. ( C ) Quantitative analysis of western blotting bands from (B). ( D ) ALP staining was observed after 7 days of mineralization. ( E ) ARS staining was performed 14 days after mineralization (Bar: 100 μm). ( F ) Quantitative assessment of ALP-positive areas after 7 days of osteogenic induction. ( G ) Semi-quantitative estimation of calcium. Data expressed as the mean ± standard deviation; n = 3. ** P < 0.01.

Article Snippet: Recombinant lentivirus of shRNA target GATA4 (shGATA4; 5′-GAATAAATCTAAGACACCA-3′), control lentivirus (shCTRL; 5′-TTCTCCGAACGTGTCACGT-3′), lentivirus to overexpress GATA4 (pcDNA-GATA4) and blank lentivirus were purchased from GenePharma (Shanghai, China).

Techniques: Over Expression, Infection, Control, Fluorescence, Microscopy, Expressing, Western Blot, Staining, Standard Deviation

GATA4 enhanced glycolysis by negatively regulating FBP1 in DPSCs. ( A ) Co-immunoprecipitated proteins were then separated using SDS-PAGE and stained. ( B ) Mass spectrometry followed by peptide sequencing identified the two proteins as fructose-1,6-bisphosphatase 1 (FBP1) and isoform CRA_d. ( C ) Immunofluorescence staining revealed that GATA4 co-localizes with FBP1 in the nucleus in DPSCs (Bar: 100 μm). ( D ) Expression pattern of GATA4 during tooth development at embryonic day 13.5 (E13.5), E14.5, E15.5, P1, and P14 (Bar: 50 μm). ( E ) FBP1 expression was tested by western blotting after infection with GATA4 lentivirus in DPSCs. ( F ) Quantitative analysis of western blotting bands from (E). ( G ) FBP1 expression was tested by western blotting after GATA4 overexpression in DPSCs. ( H ) Quantitative analysis of western blotting bands from (G). ( I, J ) knockdown of GATA4 resulted in decreased glucose consumption and lactate production. ( K, L ) Overexpression of GATA4 resulted in increased glucose consumption and lactate production. Data expressed as the mean ± standard deviation; n = 3. ** P < 0.01.

Journal: International Journal of Biological Sciences

Article Title: GATA Binding Protein 4 Regulates Tooth Root Dentin Development via FBP1

doi: 10.7150/ijbs.36567

Figure Lengend Snippet: GATA4 enhanced glycolysis by negatively regulating FBP1 in DPSCs. ( A ) Co-immunoprecipitated proteins were then separated using SDS-PAGE and stained. ( B ) Mass spectrometry followed by peptide sequencing identified the two proteins as fructose-1,6-bisphosphatase 1 (FBP1) and isoform CRA_d. ( C ) Immunofluorescence staining revealed that GATA4 co-localizes with FBP1 in the nucleus in DPSCs (Bar: 100 μm). ( D ) Expression pattern of GATA4 during tooth development at embryonic day 13.5 (E13.5), E14.5, E15.5, P1, and P14 (Bar: 50 μm). ( E ) FBP1 expression was tested by western blotting after infection with GATA4 lentivirus in DPSCs. ( F ) Quantitative analysis of western blotting bands from (E). ( G ) FBP1 expression was tested by western blotting after GATA4 overexpression in DPSCs. ( H ) Quantitative analysis of western blotting bands from (G). ( I, J ) knockdown of GATA4 resulted in decreased glucose consumption and lactate production. ( K, L ) Overexpression of GATA4 resulted in increased glucose consumption and lactate production. Data expressed as the mean ± standard deviation; n = 3. ** P < 0.01.

Article Snippet: Recombinant lentivirus of shRNA target GATA4 (shGATA4; 5′-GAATAAATCTAAGACACCA-3′), control lentivirus (shCTRL; 5′-TTCTCCGAACGTGTCACGT-3′), lentivirus to overexpress GATA4 (pcDNA-GATA4) and blank lentivirus were purchased from GenePharma (Shanghai, China).

Techniques: Immunoprecipitation, SDS Page, Staining, Mass Spectrometry, Sequencing, Immunofluorescence, Expressing, Western Blot, Infection, Over Expression, Knockdown, Standard Deviation

Exploration of potential downstream mechanism and upstream regulators of CCDC137. A Heatmap shows DEGs identified by RNA sequencing in T24-shCtrl and T24-shCCDC137-1 cells. B Bar plot displays GO and KEGG functional enrichment results of downregulated DEGs from RNA sequencing. C GSVA-Hallmark pathway enrichment analysis displayed differences between CCDC137 positive (CCDC137 +) and CCDC137 negative (CCDC137 −) cells based on single-cell sequencing data. D mRNA and protein expression of stearoyl-CoA desaturase (SCD) were detected by qRT-PCR and Western blot. E DecoupleR was used to analyze differences in transcription factor activity between CCDC137 + and CCDC137 − epithelial cells in single-cell sequencing data. F TF-Target Finder was employed to identify potential upstream transcription factors of CCDC137. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance

Journal: Journal of Translational Medicine

Article Title: CCDC137 knockdown suppresses bladder cancer progression by downregulating SCD

doi: 10.1186/s12967-025-07033-w

Figure Lengend Snippet: Exploration of potential downstream mechanism and upstream regulators of CCDC137. A Heatmap shows DEGs identified by RNA sequencing in T24-shCtrl and T24-shCCDC137-1 cells. B Bar plot displays GO and KEGG functional enrichment results of downregulated DEGs from RNA sequencing. C GSVA-Hallmark pathway enrichment analysis displayed differences between CCDC137 positive (CCDC137 +) and CCDC137 negative (CCDC137 −) cells based on single-cell sequencing data. D mRNA and protein expression of stearoyl-CoA desaturase (SCD) were detected by qRT-PCR and Western blot. E DecoupleR was used to analyze differences in transcription factor activity between CCDC137 + and CCDC137 − epithelial cells in single-cell sequencing data. F TF-Target Finder was employed to identify potential upstream transcription factors of CCDC137. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance

Article Snippet: The shCCDC137 lentiviral particles and corresponding control lentiviral particles (shCtrl) were purchased from Genechem Co., Ltd (Shanghai, China).

Techniques: RNA Sequencing, Functional Assay, Sequencing, Expressing, Quantitative RT-PCR, Western Blot, Activity Assay

In vivo validation of CCDC137 regulating tumor growth. A Subcutaneous xenograft models were established in nude mice to validate the regulatory role of CCDC137 in tumor growth. B Tumor volume growth curves were plotted over 28 days after tumor cell inoculation. C Tumor weights of T24-shCtrl and T24-shCCDC137-1 groups were measured on day 28. D The Graphical Abstract described the key results in this study. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance

Journal: Journal of Translational Medicine

Article Title: CCDC137 knockdown suppresses bladder cancer progression by downregulating SCD

doi: 10.1186/s12967-025-07033-w

Figure Lengend Snippet: In vivo validation of CCDC137 regulating tumor growth. A Subcutaneous xenograft models were established in nude mice to validate the regulatory role of CCDC137 in tumor growth. B Tumor volume growth curves were plotted over 28 days after tumor cell inoculation. C Tumor weights of T24-shCtrl and T24-shCCDC137-1 groups were measured on day 28. D The Graphical Abstract described the key results in this study. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance

Article Snippet: The shCCDC137 lentiviral particles and corresponding control lentiviral particles (shCtrl) were purchased from Genechem Co., Ltd (Shanghai, China).

Techniques: In Vivo, Biomarker Discovery

A) Western blot analysis of HeLa cells following CYB5D2 shRNA-mediated knockdown (shCYB5D2) compared to shRNA control (shCTRL) HeLa cells. B) Cell proliferation of HeLa cells following CYB5D2 knockdown. Experiments were conducted in quadruplicate, with triplicate replicates in each experiment. Cell numbers determined at each time point are presented as mean ± SD. ** p <0.01 (two-tailed Student’s t -test). C) Anchorage-independent growth of shCYB5D2 and shCTRL HeLa cells. Representative images of soft agar plates (top panels) and phase contrast images of colonies at 50X magnification (bottom panels). Scale bar is equal to 200 µm. D) Mean number (left panel) and mean diameter (right panel) of colonies in 10 random fields were evaluated and presented as mean ± S.E.M. of three independent experiments. ** p <0.01 (two-tailed Student’s t -test).

Journal: PLoS ONE

Article Title: CYB5D2 Requires Heme-Binding to Regulate HeLa Cell Growth and Confer Survival from Chemotherapeutic Agents

doi: 10.1371/journal.pone.0086435

Figure Lengend Snippet: A) Western blot analysis of HeLa cells following CYB5D2 shRNA-mediated knockdown (shCYB5D2) compared to shRNA control (shCTRL) HeLa cells. B) Cell proliferation of HeLa cells following CYB5D2 knockdown. Experiments were conducted in quadruplicate, with triplicate replicates in each experiment. Cell numbers determined at each time point are presented as mean ± SD. ** p <0.01 (two-tailed Student’s t -test). C) Anchorage-independent growth of shCYB5D2 and shCTRL HeLa cells. Representative images of soft agar plates (top panels) and phase contrast images of colonies at 50X magnification (bottom panels). Scale bar is equal to 200 µm. D) Mean number (left panel) and mean diameter (right panel) of colonies in 10 random fields were evaluated and presented as mean ± S.E.M. of three independent experiments. ** p <0.01 (two-tailed Student’s t -test).

Article Snippet: CYB5D2 shRNA (shCYB5D2) and non-specific shRNA control (shCTRL) lentiviral pool plasmids were purchased from Santa Cruz Biotechnology Inc., and packaged in 293T cells by co-transfecting each shRNA plasmid pool (10 μg) with plasmids (10 μg each) necessary for third-generation lentiviral production (pRSV-REV, pCMV-VSV-G, pMDLg/pRRE) , using the calcium phosphate transfection method.

Techniques: Western Blot, shRNA, Knockdown, Control, Two Tailed Test

A) Dual immunofluorescence of FLAG-tagged CYB5D2 and CYPOR-YFP. Stable CYB5D2-expressing HeLa cells were transiently transfected with CYPOR-YFP plasmid. Images were taken at 1000X magnification. Scale bar is equal to 5 μm. B) Western blot analysis of CYP51A1 protein levels following CYB5D2 shRNA-mediated knockdown (shCYB5D2) in HeLa cells compared to shRNA control (shCTRL) cells. C) Mevalonate treatment results in reduced survival of shCYB5D2 cells compared to shCTRL cells. D) CYP3A4 activity is reduced in shCYB5D2 cells compared to shCTRL cells, which is further evident following transiently transfecting CYPOR-YFP plasmid (+CYPOR) for 24 hours (h). E) Relative survival of HeLa cells expressing ectopic CYB5D2 or CYB5D2(D86G) compared to empty vector (EV) control cells (left panels), or shRNA control (shCTRL) and CYB5D2 shRNA-mediated knockdown (shCYB5D2) HeLa cells (right panels), following treatment with either paclitaxel (400 ng/ml), cisplatin (400 ng/ml) or doxorubicin (10 µM) for 24 and 48 h. At each time point, cell survival values were normalized to a dimethylsufloxide (DMSO)-treated control for each stable cell line. Relative cell survival values are presented as mean ± S.E.M. of three independent experiments (three replicates in each experiment). * p <0.05; ** p <0.01 (two-tailed Student’s t -test).

Journal: PLoS ONE

Article Title: CYB5D2 Requires Heme-Binding to Regulate HeLa Cell Growth and Confer Survival from Chemotherapeutic Agents

doi: 10.1371/journal.pone.0086435

Figure Lengend Snippet: A) Dual immunofluorescence of FLAG-tagged CYB5D2 and CYPOR-YFP. Stable CYB5D2-expressing HeLa cells were transiently transfected with CYPOR-YFP plasmid. Images were taken at 1000X magnification. Scale bar is equal to 5 μm. B) Western blot analysis of CYP51A1 protein levels following CYB5D2 shRNA-mediated knockdown (shCYB5D2) in HeLa cells compared to shRNA control (shCTRL) cells. C) Mevalonate treatment results in reduced survival of shCYB5D2 cells compared to shCTRL cells. D) CYP3A4 activity is reduced in shCYB5D2 cells compared to shCTRL cells, which is further evident following transiently transfecting CYPOR-YFP plasmid (+CYPOR) for 24 hours (h). E) Relative survival of HeLa cells expressing ectopic CYB5D2 or CYB5D2(D86G) compared to empty vector (EV) control cells (left panels), or shRNA control (shCTRL) and CYB5D2 shRNA-mediated knockdown (shCYB5D2) HeLa cells (right panels), following treatment with either paclitaxel (400 ng/ml), cisplatin (400 ng/ml) or doxorubicin (10 µM) for 24 and 48 h. At each time point, cell survival values were normalized to a dimethylsufloxide (DMSO)-treated control for each stable cell line. Relative cell survival values are presented as mean ± S.E.M. of three independent experiments (three replicates in each experiment). * p <0.05; ** p <0.01 (two-tailed Student’s t -test).

Article Snippet: CYB5D2 shRNA (shCYB5D2) and non-specific shRNA control (shCTRL) lentiviral pool plasmids were purchased from Santa Cruz Biotechnology Inc., and packaged in 293T cells by co-transfecting each shRNA plasmid pool (10 μg) with plasmids (10 μg each) necessary for third-generation lentiviral production (pRSV-REV, pCMV-VSV-G, pMDLg/pRRE) , using the calcium phosphate transfection method.

Techniques: Immunofluorescence, Expressing, Transfection, Plasmid Preparation, Western Blot, shRNA, Knockdown, Control, Activity Assay, Stable Transfection, Two Tailed Test

Reduced TIE2/ Tek levels with SFN are dependent on NRF2 activity. ( A ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Expression levels of 84 endothelial genes were analyzed by quantitative real-time PCR (qRT-PCR) and normalized to the geometric mean of Actb , Gapdh , B2m , Gusb , and Hsp90ab1 levels. Volcano plot comparing gene expression of vehicle- versus SFN-treated cells. A fold of change greater than 1.5 is represented by yellow (increased expression when compared to vehicle-treated cells) and blue (decreased expression when compared to vehicle-treated cells) dots. Data are the mean of n = 4. Statistical analysis was performed with the GeneGlobe Data Analysis Center from Qiagen. A p -value < than 0.05 was considered significant and is represented by a line. A red square highlights the Tek gene. ( B ) Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control from bEnd.3 cells maintained under low-serum conditions (16 h, 1% FBS) and treated with SFN (5 µM, 16 h). ( C ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of B expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( D ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Transcript levels of Hmox1 , Nqo1 , Slc7a11 , Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( E ) Confocal analysis of double immunofluorescence with anti-TIE2 (green) and anti-CLDN5 (red) antibodies in vehicle (Veh.) or SFN-treated bEnd.3 cells. ( F ) Quantification of TIE2 and CLDN5 intensity signals in E. Values are mean ± SD (n = 3, with >50 cells counted per field). * p < 0.05 vs. VEH-treated cells according to Student’s t -test. ( G ) bEnd.3 cells were transduced with lentiviral vectors carrying short hairpin RNA against NRF2 (shNRF2) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. ( H ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of G expressed as a ratio of LMNB and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and ** p < 0.01 vs. vehicle, or # p < 0.05 vs. shCTRL according to Student’s t -test. ( I ) Transcript levels of Nfe2l2 , Hmox1 , Nqo1 , and Slc7a11 and ( J ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with shNRF2 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test.

Journal: International Journal of Molecular Sciences

Article Title: Modulation of the Receptor Tyrosine Kinase TIE2/ Tek Pathway by NRF2 Activation in Neurovascular Endothelial Cells

doi: 10.3390/ijms27020770

Figure Lengend Snippet: Reduced TIE2/ Tek levels with SFN are dependent on NRF2 activity. ( A ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Expression levels of 84 endothelial genes were analyzed by quantitative real-time PCR (qRT-PCR) and normalized to the geometric mean of Actb , Gapdh , B2m , Gusb , and Hsp90ab1 levels. Volcano plot comparing gene expression of vehicle- versus SFN-treated cells. A fold of change greater than 1.5 is represented by yellow (increased expression when compared to vehicle-treated cells) and blue (decreased expression when compared to vehicle-treated cells) dots. Data are the mean of n = 4. Statistical analysis was performed with the GeneGlobe Data Analysis Center from Qiagen. A p -value < than 0.05 was considered significant and is represented by a line. A red square highlights the Tek gene. ( B ) Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control from bEnd.3 cells maintained under low-serum conditions (16 h, 1% FBS) and treated with SFN (5 µM, 16 h). ( C ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of B expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( D ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Transcript levels of Hmox1 , Nqo1 , Slc7a11 , Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( E ) Confocal analysis of double immunofluorescence with anti-TIE2 (green) and anti-CLDN5 (red) antibodies in vehicle (Veh.) or SFN-treated bEnd.3 cells. ( F ) Quantification of TIE2 and CLDN5 intensity signals in E. Values are mean ± SD (n = 3, with >50 cells counted per field). * p < 0.05 vs. VEH-treated cells according to Student’s t -test. ( G ) bEnd.3 cells were transduced with lentiviral vectors carrying short hairpin RNA against NRF2 (shNRF2) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. ( H ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of G expressed as a ratio of LMNB and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and ** p < 0.01 vs. vehicle, or # p < 0.05 vs. shCTRL according to Student’s t -test. ( I ) Transcript levels of Nfe2l2 , Hmox1 , Nqo1 , and Slc7a11 and ( J ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with shNRF2 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test.

Article Snippet: Lentiviral vector pLKO.1 shRNA control (shCtrl) (Addgene Plasmid #10879) was purchased from Addgene; pLKO-puro shNRF2 (NM_010902) was purchased from Sigma-Aldrich.

Techniques: Activity Assay, Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Gene Expression, Western Blot, Control, Immunofluorescence, Transduction, shRNA, Sequencing

Overexpression of NRF2 alters TIE2/ Tek levels. ( A ) bEnd.3 cells were transduced with lentiviral vectors carrying overexpressed NRF2 insensitive to KEAP1 degradation (NRF2 ∆ETGE ) or a lentivirus empty vector. Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control. ( B ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of A expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. empty vector according to Student’s t -test. ( C ) Transcript levels of Hmox1 , Nqo1 , and Slc7a11 and ( D ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with NRF2 ∆ETGE or empty vector maintained under low-serum conditions (16 h, 1% FBS) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). ** p < 0.01 and *** p < 0.001 vs. empty vector according to Student’s t -test. ( E ) bEnd.3 cells were transduced with lentiviral vectors NRF2 ∆ETGE or an empty vector. Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and were subjected to ANGPT1 (400 ng/mL) purified from supernatant HEK293T-stable expression (CMP-ANGPT1) to the indicated time points. Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control. ( F ) Densitometric quantification of NRF2, TIE2, and CLDN5 protein levels from representative immunoblots of E expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. time 0 according to a one-way ANOVA followed by a Bonferroni post hoc test.

Journal: International Journal of Molecular Sciences

Article Title: Modulation of the Receptor Tyrosine Kinase TIE2/ Tek Pathway by NRF2 Activation in Neurovascular Endothelial Cells

doi: 10.3390/ijms27020770

Figure Lengend Snippet: Overexpression of NRF2 alters TIE2/ Tek levels. ( A ) bEnd.3 cells were transduced with lentiviral vectors carrying overexpressed NRF2 insensitive to KEAP1 degradation (NRF2 ∆ETGE ) or a lentivirus empty vector. Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control. ( B ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of A expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. empty vector according to Student’s t -test. ( C ) Transcript levels of Hmox1 , Nqo1 , and Slc7a11 and ( D ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with NRF2 ∆ETGE or empty vector maintained under low-serum conditions (16 h, 1% FBS) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). ** p < 0.01 and *** p < 0.001 vs. empty vector according to Student’s t -test. ( E ) bEnd.3 cells were transduced with lentiviral vectors NRF2 ∆ETGE or an empty vector. Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and were subjected to ANGPT1 (400 ng/mL) purified from supernatant HEK293T-stable expression (CMP-ANGPT1) to the indicated time points. Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control. ( F ) Densitometric quantification of NRF2, TIE2, and CLDN5 protein levels from representative immunoblots of E expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. time 0 according to a one-way ANOVA followed by a Bonferroni post hoc test.

Article Snippet: Lentiviral vector pLKO.1 shRNA control (shCtrl) (Addgene Plasmid #10879) was purchased from Addgene; pLKO-puro shNRF2 (NM_010902) was purchased from Sigma-Aldrich.

Techniques: Over Expression, Transduction, Plasmid Preparation, Western Blot, Control, Quantitative RT-PCR, Purification, Expressing

Repression of TIE2/ Tek levels by NRF2 is not dependent on BACH1. ( A ) Subcellular fraction from bEnd.3 maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM) and hemin (10 µM) treatments for 16 h. Representative immunoblots of NRF2 (arrowhead), BACH1, TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. Densitometric quantification of BACH1 ( B ), NRF2 nuclear ( C ), TIE2 cytosol ( D ), and HO-1 cytosol ( E ) protein levels from representative immunoblots of A expressed as a ratio of LMNB for nuclear fraction and GAPDH for cytosol fraction, respectively. Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( F , G ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM) and hemin (10 µM) treatments for 16 h. Transcript levels of Hmox1 , Nqo1 , and Slc7a11 ( F ) and Tek , Bach1 , and Cldn5 ( G ) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( H ) bEnd.3 cells were transduced with lentiviral vectors carrying short hairpin RNA against BACH1 (shBACH1) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), BACH1, TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control. ( I ) Densitometric quantification of NRF2, BACH1, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of H expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or ### p < 0.001 vs. shCTRL according to Student’s t -test. ( J ) Transcript levels of Hmox1 , Nqo1 , Bach1 , Tek , and Cldn5 from bEnd.3 cells transduced with shBACH1 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test. ns indicates not significant.

Journal: International Journal of Molecular Sciences

Article Title: Modulation of the Receptor Tyrosine Kinase TIE2/ Tek Pathway by NRF2 Activation in Neurovascular Endothelial Cells

doi: 10.3390/ijms27020770

Figure Lengend Snippet: Repression of TIE2/ Tek levels by NRF2 is not dependent on BACH1. ( A ) Subcellular fraction from bEnd.3 maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM) and hemin (10 µM) treatments for 16 h. Representative immunoblots of NRF2 (arrowhead), BACH1, TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. Densitometric quantification of BACH1 ( B ), NRF2 nuclear ( C ), TIE2 cytosol ( D ), and HO-1 cytosol ( E ) protein levels from representative immunoblots of A expressed as a ratio of LMNB for nuclear fraction and GAPDH for cytosol fraction, respectively. Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( F , G ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM) and hemin (10 µM) treatments for 16 h. Transcript levels of Hmox1 , Nqo1 , and Slc7a11 ( F ) and Tek , Bach1 , and Cldn5 ( G ) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( H ) bEnd.3 cells were transduced with lentiviral vectors carrying short hairpin RNA against BACH1 (shBACH1) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), BACH1, TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control. ( I ) Densitometric quantification of NRF2, BACH1, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of H expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or ### p < 0.001 vs. shCTRL according to Student’s t -test. ( J ) Transcript levels of Hmox1 , Nqo1 , Bach1 , Tek , and Cldn5 from bEnd.3 cells transduced with shBACH1 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test. ns indicates not significant.

Article Snippet: Lentiviral vector pLKO.1 shRNA control (shCtrl) (Addgene Plasmid #10879) was purchased from Addgene; pLKO-puro shNRF2 (NM_010902) was purchased from Sigma-Aldrich.

Techniques: Western Blot, Control, Quantitative RT-PCR, Transduction, shRNA, Sequencing

NRF2 does not modify Tek mRNA stability and does not bind its promoter. ( A ) bEnd.3 were maintained under low-serum conditions (16 h, 1% FBS), pre-treated with SFN (5 µM, 6 h), and subsequently subjected to actinomycin D (5 µg/mL) or sustained SFN (5 µM) at the indicated time points. The graph depicts the natural logarithm of the relative levels of the Tek mRNA as a function of actinomycin D or actinomycin D/SFN incubation time, normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . The mRNA half-life was determined using the linear part of the degradation curve. Data are mean ± S.D. (n = 3). No statistically significant differences ( p ≤ 0.05) were detected between vehicle- and SFN-treated groups at any of the analyzed time points according to a two-way ANOVA followed by a Bonferroni post hoc test. ( B ) Representative immunoblots of NRF2 (arrowhead) and TIE2, as well as VCL as a loading control, from bEnd.3 were maintained under low-serum conditions (16 h, 1% FBS), pre-treated with SFN (5 µM, 6 h), and subsequently subjected to CHX (100 µM) or sustained SFN (5 µM) at the indicated time points. ( C ) The graph depicts the natural logarithm of the relative levels of the TIE2 protein as a function of CHX or CHX/SFN incubation time from representative immunoblots of A normalized to VCL. The protein half-life was determined using the linear part of the degradation curve. Data are mean ± S.D. (n = 3). No statistically significant differences ( p ≤ 0.05) were detected between vehicle- and SFN-treated groups at any of the analyzed time points according to a two-way ANOVA followed by a Bonferroni post hoc test. ( D ) bEnd.3 cells were transduced with lentiviral vectors carrying overexpressed NRF2 insensitive to KEAP1 degradation (NRF2 ∆ETGE ) or a lentivirus empty vector. Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS). Chromatin immunoprecipitation (ChIP) analysis was performed with anti-IgG or anti-PolII antibodies, and the potential AREs in Tek with the highest were analyzed by qRT-PCR. The figure shows representative data normalized as the fold of enrichment with the anti-PolII antibody vs. the IgG antibody. The presence of already known AREs in Hmox1 (ARE1), Hmox1 (ARE2), and Nqo1 was analyzed as a positive control, and Actb was amplified as a negative control.

Journal: International Journal of Molecular Sciences

Article Title: Modulation of the Receptor Tyrosine Kinase TIE2/ Tek Pathway by NRF2 Activation in Neurovascular Endothelial Cells

doi: 10.3390/ijms27020770

Figure Lengend Snippet: NRF2 does not modify Tek mRNA stability and does not bind its promoter. ( A ) bEnd.3 were maintained under low-serum conditions (16 h, 1% FBS), pre-treated with SFN (5 µM, 6 h), and subsequently subjected to actinomycin D (5 µg/mL) or sustained SFN (5 µM) at the indicated time points. The graph depicts the natural logarithm of the relative levels of the Tek mRNA as a function of actinomycin D or actinomycin D/SFN incubation time, normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . The mRNA half-life was determined using the linear part of the degradation curve. Data are mean ± S.D. (n = 3). No statistically significant differences ( p ≤ 0.05) were detected between vehicle- and SFN-treated groups at any of the analyzed time points according to a two-way ANOVA followed by a Bonferroni post hoc test. ( B ) Representative immunoblots of NRF2 (arrowhead) and TIE2, as well as VCL as a loading control, from bEnd.3 were maintained under low-serum conditions (16 h, 1% FBS), pre-treated with SFN (5 µM, 6 h), and subsequently subjected to CHX (100 µM) or sustained SFN (5 µM) at the indicated time points. ( C ) The graph depicts the natural logarithm of the relative levels of the TIE2 protein as a function of CHX or CHX/SFN incubation time from representative immunoblots of A normalized to VCL. The protein half-life was determined using the linear part of the degradation curve. Data are mean ± S.D. (n = 3). No statistically significant differences ( p ≤ 0.05) were detected between vehicle- and SFN-treated groups at any of the analyzed time points according to a two-way ANOVA followed by a Bonferroni post hoc test. ( D ) bEnd.3 cells were transduced with lentiviral vectors carrying overexpressed NRF2 insensitive to KEAP1 degradation (NRF2 ∆ETGE ) or a lentivirus empty vector. Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS). Chromatin immunoprecipitation (ChIP) analysis was performed with anti-IgG or anti-PolII antibodies, and the potential AREs in Tek with the highest were analyzed by qRT-PCR. The figure shows representative data normalized as the fold of enrichment with the anti-PolII antibody vs. the IgG antibody. The presence of already known AREs in Hmox1 (ARE1), Hmox1 (ARE2), and Nqo1 was analyzed as a positive control, and Actb was amplified as a negative control.

Article Snippet: Lentiviral vector pLKO.1 shRNA control (shCtrl) (Addgene Plasmid #10879) was purchased from Addgene; pLKO-puro shNRF2 (NM_010902) was purchased from Sigma-Aldrich.

Techniques: Incubation, Western Blot, Control, Transduction, Plasmid Preparation, Chromatin Immunoprecipitation, Quantitative RT-PCR, Positive Control, Amplification, Negative Control

Depletion of pyruvate kinase M2 (PKM2) reduces the tumorigenic capacity of cells with lowly expressed lincRNA‐p21. (A) LincRNA‐p21‐silenced LNCaP cells expressing shPKM2 or shCtrl were implanted into nude mice (n = 8) and tumours developed. The time point of 0 day represented 3 weeks after LNCaP cells injection. (B) LincRNA‐p21‐silenced DU145 cells expressing shPKM2 or shCtrl were implanted into nude mice (n = 8) and tumours developed. Immunoblotting was preformed to examine PKM2 expression (left). Tumour initiation were recorded (middle) and survival was analysed (right)

Journal: Cell Proliferation

Article Title: Linc RNA ‐p21 suppresses development of human prostate cancer through inhibition of PKM 2

doi: 10.1111/cpr.12395

Figure Lengend Snippet: Depletion of pyruvate kinase M2 (PKM2) reduces the tumorigenic capacity of cells with lowly expressed lincRNA‐p21. (A) LincRNA‐p21‐silenced LNCaP cells expressing shPKM2 or shCtrl were implanted into nude mice (n = 8) and tumours developed. The time point of 0 day represented 3 weeks after LNCaP cells injection. (B) LincRNA‐p21‐silenced DU145 cells expressing shPKM2 or shCtrl were implanted into nude mice (n = 8) and tumours developed. Immunoblotting was preformed to examine PKM2 expression (left). Tumour initiation were recorded (middle) and survival was analysed (right)

Article Snippet: ShlincRNA‐p21, shPKM2 and control shRNA (shCtrl) lentivirus particles were obtained from GenePharma.

Techniques: Expressing, Injection, Western Blot

LincRNA‐p21 down‐regulates pyruvate kinase M2 (PKM2) to suppress aerobic glycolysis. (A) Relative glucose consumption, pyruvate concentration and lactate production were quantified in lincRNA‐p21 knockdown or control DU145 or LNCaP cells. (B) Relative glucose consumption, pyruvate concentration and lactate production were quantified in lincRNA‐p21‐silenced DU145 and LNCaP cells expressing shPKM2 or shCtrl. (C) DU145 cells with lowly expressed lincRNA‐p21 were treated with or without rapamycin, and then glucose consumption, pyruvate concentration and lactate production were examined. *P< .05; **P< .01; ***P< .001

Journal: Cell Proliferation

Article Title: Linc RNA ‐p21 suppresses development of human prostate cancer through inhibition of PKM 2

doi: 10.1111/cpr.12395

Figure Lengend Snippet: LincRNA‐p21 down‐regulates pyruvate kinase M2 (PKM2) to suppress aerobic glycolysis. (A) Relative glucose consumption, pyruvate concentration and lactate production were quantified in lincRNA‐p21 knockdown or control DU145 or LNCaP cells. (B) Relative glucose consumption, pyruvate concentration and lactate production were quantified in lincRNA‐p21‐silenced DU145 and LNCaP cells expressing shPKM2 or shCtrl. (C) DU145 cells with lowly expressed lincRNA‐p21 were treated with or without rapamycin, and then glucose consumption, pyruvate concentration and lactate production were examined. *P< .05; **P< .01; ***P< .001

Article Snippet: ShlincRNA‐p21, shPKM2 and control shRNA (shCtrl) lentivirus particles were obtained from GenePharma.

Techniques: Concentration Assay, Knockdown, Control, Expressing

Pyruvate kinase M2 (PKM2) is critical for lincRNA‐p21 suppression of cell proliferation and colony formation of prostate cancer cells. (A) LincRNA‐p21‐silenced DU145 cells expressing shPKM2 or shCtrl were subjected to cell viability analysis at indicated time. (B and C) Cells described in (A) were subjected to colony formation assay. Representative images of cell colonies (B) and relative colony number were calculated (C). (D) LincRNA‐p21‐silenced LNCaP cells expressing shPKM2 or shCtrl were subjected to cell viability analysis at indicated time. (E and F) Cells described in (D) were subjected to colony formation assay. Representative images of cell colonies (E) and relative colony number were calculated (F). (G and H) DU145 cells with lowly expressed lincRNA‐p21 were treated with or without rapamycin (G) or 3‐Brpa (H) at different dosages for 48 hours, and cell viability was examined using CCK8 kit. *P< .05; **P< .01; ***P< .001

Journal: Cell Proliferation

Article Title: Linc RNA ‐p21 suppresses development of human prostate cancer through inhibition of PKM 2

doi: 10.1111/cpr.12395

Figure Lengend Snippet: Pyruvate kinase M2 (PKM2) is critical for lincRNA‐p21 suppression of cell proliferation and colony formation of prostate cancer cells. (A) LincRNA‐p21‐silenced DU145 cells expressing shPKM2 or shCtrl were subjected to cell viability analysis at indicated time. (B and C) Cells described in (A) were subjected to colony formation assay. Representative images of cell colonies (B) and relative colony number were calculated (C). (D) LincRNA‐p21‐silenced LNCaP cells expressing shPKM2 or shCtrl were subjected to cell viability analysis at indicated time. (E and F) Cells described in (D) were subjected to colony formation assay. Representative images of cell colonies (E) and relative colony number were calculated (F). (G and H) DU145 cells with lowly expressed lincRNA‐p21 were treated with or without rapamycin (G) or 3‐Brpa (H) at different dosages for 48 hours, and cell viability was examined using CCK8 kit. *P< .05; **P< .01; ***P< .001

Article Snippet: ShlincRNA‐p21, shPKM2 and control shRNA (shCtrl) lentivirus particles were obtained from GenePharma.

Techniques: Expressing, Colony Assay

a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

Journal: bioRxiv

Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP

doi: 10.1101/2025.07.16.665171

Figure Lengend Snippet: a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

Article Snippet: Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882).

Techniques: Immunofluorescence, Expressing, Sequencing, Plasmid Preparation, Selection